Week 1 Problem Set

In: Business and Management

Submitted By bunnehkinsxo
Words 958
Pages 4
Week 1 Problem Set
Answer the following questions and solve the following problems in the space provided. When you are done, save the file in the format flastname_Week_1_Problem_Set.docx, where flastname is your first initial and you last name, and submit it to the appropriate dropbox.
Chapter 1 (page 19)
1.
What is the most important difference between a corporation and all other organizational forms?

2.
What does the phrase limited liability mean in a corporate context?

3.
Which organizational forms give their owners limited liability?

4.
What are the main advantages and disadvantages of organizing a firm as a corporation?

5.
Explain the difference between an S corporation and a C corporation.

Chapter 2
The following is provided for use in answering the next set of questions. You may also find table 2.5 on page 53 of your text and all questions on pages 56–57.
-------------------------------------------------
TABLE 2.5 2009–2013 Financial Statement Data and Stock Price Data for Mydeco Corp. Mydeco Corp. 2009–2013 | (All data as of fiscal year end; in $ million) | Income Statement | 2009 | 2010 | 2011 | 2012 | 2013 | RevenueCost of Goods Sold | 404.3(188.3) | 363.8(173.8) | 424.6(206.2) | 510.7(246.8) | 604.1(293.4) | Gross ProfitSales and MarketingAdministrationDepreciation and Amortization | 216.0(66.7)(60.6)(27.3) | 190.0(66.4)(59.1)(27.0) | 218.4(82.8)(59.4)(34.3) | 263.9(102.1)(66.4)(38.4) | 310.7(120.8)(78.5)(38.6) | EBITInterest Income (Expense) | 61.4(33.7) | 37.5(32.9) | 41.9(32.2) | 57.0(37.4) | 72.8(39.4) | Pretax IncomeIncome Tax | 27.7 (9.7) | 4.6(1.6) | 9.7(3.4) | 19.6(6.9) | 33.4(11.7) | Net Income Shares outstanding (millions) Earnings per share | 18.0 55.0 $0.33 | 3.055.0$0.05 | 6.355.0$0.11 | 12.755.0$0.23 | 21.755.0$0.39 | Balance Sheet | 2009 | 2010 | 2011 | 2012 | 2013 |…...

Similar Documents

Mba510 Problem Set 1

...Week 3 Problem Set 1: Chapter 3: 62, 72 62) The Citizens Banking Company is studying the number of times the ATM located in a Lob laws Supermarket at the foot of Market Street is used per day. Following are the numbers of times the machine was used over each of the last 30 days. Determine the mean number of times the machine was used per day. 83 64 84 76 84 54 75 59 70 6163 80 84 73 68 52 65 90 52 7795 36 78 61 59 84 95 47 87 60 Answer: The ATM machine was used a mean number of times 70. 53. 72.) The weights (in pounds) of a sample of five boxes being sent by UPS are: 12, 6, 7, 3, and 10. 1. Compute the range. 3-12 2. Compute the mean deviation. 7.6 3. Compute the standard deviation. Chapter 5, 66 66) A survey of undergraduate students in the School of Business at Northern University Revealed the following regarding the gender and majors of the students: Major Gender Accounting Management Finance Total |Gender |Accounting |Major/management |Finance |Total | |Male |100 |150 |50 |300 | |Female |100 |50 |50 |200 | |Total |200 |200 |100 |500 ......

Words: 478 - Pages: 2

Problem Set 1

...Problem Set 1 Complete all questions listed below. Clearly label your answers. 1. The receipts and year of release of the five movies with the largest nominal box office revenues, along with the CPI data of each year are presented below. Assuming that the receipts for each of the movies were derived during their year of release, convert the receipts for each to real dollars for the year 2010 (2010 CPI 218.1). Put the movies in order from largest to smallest real box office receipts. Movies | NominalBox Office Receipts (millions) | Year Released | CPI in Year Released. | Avatar | $760.50 | 2009 | 214.5 | Titanic | 600.8 | 1997 | 160.5 | Star Wars | 461 | 1977 | 60.5 | Shrek 2 | 437.2 | 2004 | 188.9 | E.T. The Extra-Terrestrial | 399.9 | 1982 | 96.5 | Answer: 1)Star Wars = 1661.89 2)ET = 903.82 3)Titanic = 816.41 4)Avatar = 773.26 5)Shrek 2 = 504.78 2. Classify each of the following as employed, unemployed, or not in the labor force. a. Beth is not working; she applied for a job at Wal-Mart last week and is awaiting the result of her application. Answer: Unemployed b. Juan is vacationing in Florida during a layoff at General Motors plant due to a model changeover, but he expects to be recalled in a couple of weeks. Answer: Employed c. Bob was laid off as a carpenter when a construction project was completed. He is looking for work but has been unable to find anything except a $10 per hour job which he......

Words: 592 - Pages: 3

Macroeconomics Problem Set 1

...Amanda Taliaferro ECON214-B12 Problem Set #1 August 26, 2014 Problem Set 1 Complete all questions listed below. Clearly label your answers. 1. The receipts and year of release of the five movies with the largest nominal box office revenues, along with the CPI data of each year are presented below. Assuming that the receipts for each of the movies were derived during their year of release, convert the receipts for each to real dollars for the year 2010 (2010 CPI 218.1). Put the movies in order from largest to smallest real box office receipts. Movies | NominalBox Office Receipts (millions) | Year Released | CPI in Year Released. | Avatar | $760.50 | 2009 | 214.5 | Titanic | 600.8 | 1997 | 160.5 | Star Wars | 461 | 1977 | 60.5 | Shrek 2 | 437.2 | 2004 | 188.9 | E.T. The Extra-Terrestrial | 399.9 | 1982 | 96.5 | Star Wars= $1664.21 E.T.= $903.77 Titanic= $817.09 Avatar= $773.43 Shrek= $507.15 2. Classify each of the following as employed, unemployed, or not in the labor force. a. Beth is not working; she applied for a job at Wal-Mart last week and is awaiting the result of her application. Beth is unemployed. b. Juan is vacationing in Florida during a layoff at General Motors plant due to a model changeover, but he expects to be recalled in a couple of weeks. Juan is unemployed. c. Bob was laid off as a carpenter when a construction project was completed. He is looking for work but has been unable to find anything......

Words: 623 - Pages: 3

Problem Set 1

...Problem Set 1 MGT-309 – Intro to Logistics Management November 23, 2014 Cosme Lucio Professor Jerry Bilbrey 2a. 2*8*44,000=704,000 .12*.75=.09 704,000/.09= 7,822,222.222222222 = 2796.823595120404 = 2797 2b. Inventory Carrying Costs = (2,797/2)*0.75*12% = $125.87 Order Costs = (44,000/2797) = 15.73 = 16, 16*$8(per order) = $128.00 Transportation Costs = 44,000 units *0.05 per unit = 2,200 (Q=2,797) = 125.87+128+2,200= 2453.87 Inventory Carrying Costs = (4,000/2)*.075*12% = $180 Order Costs = 44,000/4,000 = 11orders, 11orders*$8 per order = $88 Transportation Costs = 44,000*$0.04 per unit = $1760.00 (Q=4,000) = 180+88+1,760 = 2,028 2c. 4,000 CUPS = 11 orders, 33 days between orders 4a. Common days’ supply of chocolate chewies at DC: DS= [(42,000 – 7,000) + 18,500]/4,500 = 11.8888889 = 12(Rounded Up) 4b. Fair Share Allocation Logic: Cincinnati Allocation = (11.8888889 * 2,500) – 12,500 = 17,222.2222 Phoenix Allocation = (11.8888889 * 2,000) – 6,000 = 17,777.7778 6a. Yes. The demand never exceeded what was in stock and causing a stockout. 6b. SD = 1.811 6c. Yes. The frequency wasn’t out of bounds with mean, mode, median. 6d. SD = 1.095445 6e. SD of Combined Probabilities = 6 6g. f(k) = 0.061667 6h. k = 1.1, Required safety stock for the desired 99 percent is 6.42 with an average inventory of 36 6i....

Words: 252 - Pages: 2

Economics Problems Set 1

...MBA-FP6008: Assessment 1, Economics Problem Set 1 Dennis J. Johnson Capella University 08/12/2015 Problems A, B, and C Introduction This assessment will be an analysis of graphed data and changes in supply and demand for three economic problems. Problem A involves production possibilities for consumer and capital goods, problem B is an evaluation of changes in supply and demand equilibrium, and finally, problem C involves pricing with relevance to supply and demand. Successful completion of this assessment demonstrates proficiency in; applying theories, models, and practices of economic theory, analyzing solutions with support from relevant data, resources, references, and economic principles, analyzing graphed and circular flow diagram data, and analyzing changes in supply and demand in a competitive market. Problem A. Production Possibilities | Type of Production | Production Alternative A | Production Alternative B | Production Alternative C | Production Alternative D | Production Alternative E | Butter | 0 | 1 | 2 | 3 | 4 | Guns | 15 | 14 | 12 | 9 | 0 | Production Possibilities for Consumer Goods (Guns) and Capital Goods (Butter) 1. The specific assumptions that underlie the production possibilities curve are: that there are only two goods, consumer and capital, that they are produced in different proportions in the economy, the quantities of the resources do not change, production techniques are given and constant, and that resources......

Words: 1353 - Pages: 6

Financial Week 1 Problem Set

...Name: Y Duc Pham (andy) Week 1 Problem Set Answer the following questions and solve the following problems in the space provided. When you are done, save the file in the format flastname_Week_1_Problem_Set.docx, where flastname is your first initial and you last name, and submit it to the appropriate dropbox. Chapter 1 (page 19) 1. What is the most important difference between a corporation and all other organizational forms? Having separate entity, opportunity to raise money easily, unlimited life. 2. What does the phrase limited liability mean in a corporate context? Owner lost is limited to their investment. 3. Which organizational forms give their owners limited liability? LLC, Corporation, limit partnership 4. What are the main advantages and disadvantages of organizing a firm as a corporation? Dis: double taxation, a lot of paper work, lack of control… Ad: issuing stock, raise money easily, infinity life… 5. Explain the difference between an S corporation and a C corporation. S Corporation: limited shareholder… C Corporation: unlimited shareholder, double taxation… Chapter 2 The following is provided for use in answering the next set of questions. You may also find table 2.5 on page 53 of your text and all questions on pages 56–57. ------------------------------------------------- TABLE 2.5 2009–2013 Financial Statement Data and Stock Price Data for Mydeco Corp. Mydeco Corp. 2009–2013 | (All data as of fiscal year end; in $ million) | ......

Words: 1229 - Pages: 5

Fin 515 Week 1 Problem Set

...FIN 515 Week 1 Problem Set http://www.homeworkwarehouse.com/downloads/fin-515-week-1-problem-set/ FIN 515 Week 1 Problem Set Chapter 1 1. What is the most important difference between a corporation and all other organizational forms? 2. What does the phrase limited liability mean in a corporate context? 3. Which organizational forms give their owners limited liability? 4. What are the main advantages and disadvantages of organizing a firm as a corporation? 5. Explain the difference between an S corporation and a C corporation. Chapter 2 The following is provided for use in answering the next set of questions. You may also find table 2.5 on page 53 of your text and all questions on pages 56–57. In fiscal year 2011, Starbucks Corporation (SBUX) had revenue of $11.70 billion, gross profit of $6.75 billion, and net income of $1.25 billion. Peet’s Coffee and Tea (PEET) had revenue of $372 million, gross profit of $72.7 million, and net income of $17.8 million. a. Compare the gross margins for Starbucks and Peet’s. b. Compare the net profit margins for Starbucks and Peet’s. c. Which firm was more profitable in 2011? See Table 2.5 showing financial statement data and stock price data for Mydeco Corp. a. How did Mydeco’s accounts receivable days change over this period? b. How did Mydeco’s inventory days change over this period? c. Based on your analysis, has Mydeco improved its management of its working capital during this time period? See Table 2.5 showing......

Words: 427 - Pages: 2

Problem Set 1

...Problem Set #1 Date 09/22/2015 Sayantani Nandy 1. Sign into Bloomberg and check IBM's page (IBM US Equity). Check Company Overview and then Company Management. Find the composition of the Management Team and the Board and check the backgrounds of the Chair as well as the top 3 longest serving board members. (a) How many of these three board members appear to be independent? (b) What are their compensations? (c) What other board memberships or executive positions do they hold? (d) Do you think having these positions help increase or reduce agency cost and help better align the interest of shareholders with management? Answer: I will start to answer the question with a table of summary: IBM Corp Inc. Sr. No Tenure . (yrs.) 1 2 Independent Board Member CompenCurrent sation shareholding Kenneth Chenault 17.8 "Ken" Other Board/Executive Positions Company Name Title Yes / No Bloomberg Philanthropists Board Member Presidents & Fellows of Harvard Board Member College Proctor & Gamble Company Board Member No American Express Travel related Chairman services Co. American Express Co. Chairman $341,193 $ 1,031,972 BM Corp. Board Member Sidney 14.8 Taurel BioCrossroads IBM McGraw Hill Financial Mc Grawhill, Compensation and Leadership Development IBM, Executive compensation $368,724 $ 2,284,797 and management resources Name Board Member Board Member Board Member No Chairman Chairman Yes 3 Joan......

Words: 2087 - Pages: 9

Fin 515 Week 1 Problem Set

...FIN 515 Week 1 Problem Set http://www.homeworkwarehouse.com/downloads/fin-515-week-1-problem-set/ FIN 515 Week 1 Problem Set Chapter 1 1. What is the most important difference between a corporation and all other organizational forms? 2. What does the phrase limited liability mean in a corporate context? 3. Which organizational forms give their owners limited liability? 4. What are the main advantages and disadvantages of organizing a firm as a corporation? 5. Explain the difference between an S corporation and a C corporation. Chapter 2 The following is provided for use in answering the next set of questions. You may also find table 2.5 on page 53 of your text and all questions on pages 56–57. In fiscal year 2011, Starbucks Corporation (SBUX) had revenue of $11.70 billion, gross profit of $6.75 billion, and net income of $1.25 billion. Peet’s Coffee and Tea (PEET) had revenue of $372 million, gross profit of $72.7 million, and net income of $17.8 million. a. Compare the gross margins for Starbucks and Peet’s. b. Compare the net profit margins for Starbucks and Peet’s. c. Which firm was more profitable in 2011? See Table 2.5 showing financial statement data and stock price data for Mydeco Corp. a. How did Mydeco’s accounts receivable days change over this period? b. How did Mydeco’s inventory days change over this period? c. Based on your analysis, has Mydeco improved its management of its working capital during this time period? See Table 2.5 showing......

Words: 427 - Pages: 2

Problem Set 1

...Problem set 1 Exercise 1 Giving €10 to a friend does not affect GDP because it is just an exchange of paper and there is no new production. Because she loses the money, she cannot go to the movies, so she cannot consume anything. That transaction does not affect France's 2014 GDP. Expenditure: consumption in services increase by €50 (only the service fee and not the loan). Income side: wages and profits should increase by €50. Value added: services value added should increase by €50. Expenditure: consumption in goods increases, but imports also increases. GDP stays the same. Income side: it does not increase in France but in the US. Value added: it increases in the US and not in France Winning the lotery is just a money transfer, it does not involve production, therefore it does not affect GDP. It is legalized so it should count in GDP and increase it, but because it is domestic production, it is not meant to be sold, so it does not affect GDP. Expenditure: consumption in non-durable goods increases by €105. Income side: wages plus profits shoul increase by €105. Value added: Restaurants value added should increase by €105. Exercise 4 (i) NominalGDP2012 = QuantityTV * PriceTV2012 + QuantityComputers * PriceComputers2012 = 100*500+20*1,000 NominalGDP2012= €70,000 NominalGDP2013 = QuantityTV * PriceTV2013 + QuantityComputers * PriceComputers2013 = 80*400+30*1,200 NominalGDP2013= €68,000 NominalGDP2014 = QuantityTV *......

Words: 930 - Pages: 4

Fin 515 Week 1 Problem Set Answers

...FIN 515 Week 1 Problem Set Answers http://homeworklance.com/downloads/fin-515-week-1-problem-set-answers/ Answer the following questions and solve the following problems in the space provided. When you are done, save the file in the format flastname_Week_1_Problem_Set.docx, where flastname is your first initial and you last name, and submit it to the appropriate dropbox. Chapter 1 (page 19) 1. What is the most important difference between a corporation and all other organizational forms? 2. What does the phrase limited liability mean in a corporate context? 3. Which organizational forms give their owners limited liability? 4. What are the main advantages and disadvantages of organizing a firm as a corporation? 5. Explain the difference between an S corporation and a C corporation. Chapter 2 The following is provided for use in answering the next set of questions. You may also find table 2.5 on page 53 of your text and all questions on pages 56–57. 29. In fiscal year 2011, Starbucks Corporation (SBUX) had revenue of $11.70 billion, gross profit of $6.75 billion, and net income of $1.25 billion. Peet’s Coffee and Tea (PEET) had revenue of $372 million, gross profit of $72.7 million, and net income of $17.8 million. a. Compare the gross margins for Starbucks and Peet’s. b. Compare the net profit margins for Starbucks and Peet’s. c. Which firm was more profitable in 2011? 31. See Table 2.5 showing financial statement data and stock price data for Mydeco Corp. a....

Words: 470 - Pages: 2

Week 5 Problem Set

...Week 5 Problem Set Answer the following questions and solve the following problems in the space provided. When you are done, save the file in the format flastname_Week_5_Problem_Set.docx, where flastname is your first initial and you last name, and submit it to the appropriate dropbox. Chapter 10 (pages 345–348): 4. You bought a stock one year ago for $50 per share and sold it today for $55 per share. It paid a $1 per share dividend today. a. R=(1+(55-50))/50= 0.12 or 12% b. div =1/50= .02 or 2% capital gain =(55-50)/50= .10 or 10% The return on the equity investment is 12% and Dividend yield is 10%. 20. Consider two local banks. Bank A has 100 loans outstanding, each for $1 million, that it expects will be repaid today. Each loan has a 5% probability of default, in which case the bank is not repaid anything. The chance of default is independent across all the loans. Bank B has only one loan of $100 million outstanding, which it also expects will be repaid today. It also has a 5% probability of not being repaid. Explain the difference between the type of risk each bank faces. Which bank faces less risk? Why? Bank A is less, but the expect pay offs are considered to be the same. Bank B= ($100 million* 0.95)= $95 million Bank A= ($1 million* 0.95)* 100= $95 million Bank B Variance=(100- 95)^2 * 0.95(0- 95)^2 * 0.05 475 =475 Standard Deviation= route 475= 21.79 Bank A Variance of each loan= (1- 0.95)^2 * 0.95(0- 95)^2 * 0.05 475 =0.0475......

Words: 1255 - Pages: 6

Fin 515 Week 1 Problem Set

...FIN 515 Week 1 Problem Set To Buy This material Click below link http://www.uoptutors.com/fin-515-devry/fin-515-week-1-problem-set Chapter 1 (page 19) 1. What is the most important difference between a corporation and all other organizational forms? 2. What does the phrase limited liability mean in a corporate context? 3. Which organizational forms give their owners limited liability? 4. What are the main advantages and disadvantages of organizing a firm as a corporation? 5. Explain the difference between an S corporation and a C corporation. Chapter 2 The following is provided for use in answering the next set of questions. You may also find table 2.5 on page 53 of your text and all questions on pages 56–57. 29. In fiscal year 2011, Starbucks Corporation (SBUX) had revenue of $11.70 billion, gross profit of $6.75 billion, and net income of $1.25 billion. Peet’s Coffee and Tea (PEET) had revenue of $372 million, gross profit of $72.7 million, and net income of $17.8 million. a. Compare the gross margins for Starbucks and Peet’s. b. Compare the net profit margins for Starbucks and Peet’s. c. Which firm was more profitable in 2011? 31. See Table 2.5 showing financial statement data and stock price data for Mydeco Corp. a. How did Mydeco’s accounts receivable days change over this period? b. How did Mydeco’s inventory days change over this period? c. Based on your analysis, has Mydeco improved its management of its working capital during this time period? 32.......

Words: 444 - Pages: 2

Problem Set 1

...Problem Set 5: 1) Advantages include the fact that polyclonal is cheaper, a mixture of different antibodies are made while monoclonal is only one specific antibody (this might depend on the experiment as some might prefer different antibodies), and large quantities are made. Disadvantages are that the affinities of the antibodies differ, a good amount of a specific antibody can’t be made alone unlike monoclonal, it is less reliable, and the same sample can’t be guaranteed each time unlike the monoclonal which can bring similar clones months later. 3) The GFP-HDAC3 overlaps the DAPI where the nucleus is. This shows that HDAC3 is a nuclear protein. However, some deletions show that the nucleus has gone smaller while others show that the nucleus has gone larger. The goal of this experiment was to find out how the different portions of the protein affected localization in the cell. The experiment does show that there was a significant effect. 4) Sense: 5’ aagccccatcgcctggcattg 3’ Linker Loop: 5’ uucaagaga 3’ Antisense: 5’ caatgccaggcgatggggctt 3’ Poly U: UUUUU The goal of the knockout would be to see if the removed proteins had any effect on the function of the cell. The siRNA should be 30%-50% GC content, 21 bp in length, have a AA on the 5’ end, a linker, around 75 bp ds of the gene, and have a poly U tail. These conditions are satisfied but the GC content is slightly high. 5) Fold increase in HDAC3 mRNA gene in control vs experiment = 1488/151= 9.85 fold......

Words: 364 - Pages: 2

Problem Set 1

...Problem Set 1 Problem 1 Which project should the firm select? Why? Project B: Managers should try to maximize their stock’s intrinsic value while also bringing in revenue. The P/E ratio shows the dollar amount investors will pay for $1 of current earnings. Problem 2 If most investors expect the same cash flows from Companies A and B but are more confident that A’s cash flows will be closer to their expected value, which company should have the higher stock price? Explain. The primary goal of a corporation should be to maximize its owner’s value. If a manager is to maximize shareholder wealth, he/she must know how that wealth is determined. Fundamentally, shareholder wealth is the number of shares outstanding at times the market price per share. A stock’s price at any given time depends on the cash flows a “marginal” investor expects to receive after buying the stock. With that being said, Company A’s cash flow would increase the stock price and the risk would be minimal. Management’s goal should be to make decisions designed to maximize the stock’s price. Problem 3 The president of Southern Semiconductor Corporation (SSC) made this statement in the company’s annual report: “SSC’s primary goal is to increase the value of our common stock holders’ equity.” Later in the report, the following announcements were made: a. The company contributed $1.5 million to the symphony orchestra in Birmingham, Alabama, its headquarters city b. The company is spending $500......

Words: 628 - Pages: 3